Senolytic therapy alleviates physiological human brain aging and … – Nature.com

Ethics and biological safety

All animal experiments were performed according to guidelines promoting the wellbeing of animals used for scientific research from The University of Queensland (UQ), and according to the Australian code for the care and use of animals for scientific purposes. The use of animals was approved by the UQ Animal Ethics Committee under project no. 2021/AE001119. Mice were housed within the BSL-3 facility using the IsoCage N-Biocontainment System (Tecniplast), where each cage was supplied with a high-efficiency, particulate-absorbing filter preventing viral contamination between cages. This IsoCage system also provides individual ventilation to the cages, maintaining humidity at <6570% and temperature 2023C. Mice were kept under a 12/12h light/dark cycle with food and water provided ad libitum.

Pathogenic SARS-CoV-2 variants and encephalitic flaviviruses were handled under certified biosafety level-3 (BSL-3) conditions at the School of Chemistry and Molecular Biosciences (SCMB), Australian Institute for Bioengineering and Nanotechnology and Institute for Molecular Bioscience at UQ. All approved researchers used disposable Tychem2000 coveralls (Dupont, no. TC198TYL) at all times and also used either powered air-purifying respirators (PAPR, SR500 Fan Unit) or Versaflopowered airpurifying respirators (3M, no. 9020399) as respiratory protection. All pathogenic materials were handled in a classII biosafety cabinet within the BSL-3 facility. For downstream analysis, all samples containing infectious viruses were appropriately inactivated in accordance with the BSL-3 manual. Liquid and solid waste were steam sterilized by autoclave. This study was approved by the Institutional Biosafety Committee from UQ under approval nos. IBC/485B/SCMB/2021 and IBC/447B/SCMB/2021. Differentiation of hPSCs into organoids and their subsequent use was approved by the UQ Institutional Research Ethics Committee under approval no. 2019000159. The WA09 PSC cell line was obtained before this study following receipt of informed consent and approval by the NIH hESC Registry (no. NIHhESC-10-0062). Analysis of human brain sections was performed with the approval of the Ethics Committee of the University of Freiburg (no. 10008/09). Consent for autopsy was provided by the individuals next of kin or healthcare proxy according to German law (participant compensation was not applicable). The study was performed in agreement with the principles expressed in the Declaration of Helsinki, 2013.

Organoid generation was carried out as previously described55, with some modifications. Human WA09 hPSCs were obtained, contamination free, from WiCell, with verified normal karyotype and were routinely tested and confirmed negative for mycoplasma (MycoAlert, Lonza). hPSCs were maintained in mTeSR medium (STEMCELL Technologies, no. 85850) on matrigel-coated plates (Corning, no. 354234). On day0 of organoid differentiation, PSCs were dissociated with Accutase (Life Technologies, no. 00-4555-56) and seeded at a density of 15,000cells per well on a 96-well, low-attachment U-bottom plate (Sigma, no. CLS7007) in mTeSR plus 10M ROCK inhibitor (VWR, no. 688000-5). The 96-well plate was then spun at 330g for 5min to aggregate the cells and create spheroids. The spheroids were fed every day for 5days in medium containing DMEM/F12 (Invitrogen, no. 11330-032), knockout serum (Invitrogen, no. 11320-033), 1:100 GlutaMax, 1:200 MEM-NEAA supplemented with dual SMAD inhibitors, 2M dorsomorphin (StemMACS, no. 130-104-466) and 2M A-83-01 (Lonza, no. 9094360). On day6, half of the medium was changed to induction medium containing DMEM/F12, 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement (Invitrogen, no. 17502048) and 1gml1 heparin (Sigma, no. H3149) supplemented with 1M CHIR 99021 (Lonza, no. 2520691) and 1M SB-431542 (Sigma, no. S4317). From day7, complete medium change was carried out with induction medium followed by daily medium change in induction medium for the next 4days. On day11 of the protocol, spheroids were transferred to 10l droplets of Matrigel on a sheet of Parafilm with 2mm dimples. These droplets were allowed to gel at 37C for 25min and were subsequently removed from the Parafilm and transferred to, and maintained in, low-attachment 24-well plates (Sigma, no. CLS3473) containing induction medium for the following 5days. From day16 the medium was then changed to organoid medium containing a 1:1 mixture of neurobasal medium (Invitrogen, no. 21103049) and DMEM/F12 medium supplemented with 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement, 1:50 B27 supplement (Invitrogen, no. 12587010), 1% penicillin/streptomycin (Sigma, no. P0781), 50M 2-mercaptoethanol and 0.25% insulin solution (Sigma, no. I9278). Medium was changed every other day with organoid medium. BOs were maintained in organoid medium until the end of experiments, as indicated. Microglia-containing organoid generation was carried out as previously described56 and these BOs were matured for 3months before SARS-CoV-2 exposure at MOI=1.

Frontal cortex tissue from patients that had tested positive for SARS-CoV-2 and died from severe COVID-19 was obtained at the University Medical Center Freiburg, Germany. Tissue was formalin fixed and embedded in paraffin using a Tissue Processing Center (Leica, no. ASP300). Sections (3m thick) were cut and mounted on Superfrost objective slides (Langenbrinck).

RNA Vero E6 cells (African green monkey kidney cell clones) and TMPRSS2-expressing Vero E6 cell lines were maintained in DMEM (Gibco) at 37C with 5% CO2. In addition, as previously described, the TMPRSS2-expressing Vero E6 cell line was supplemented with 30gml1 puromycin57. C6/36 cells, derived from the salivary gland of the mosquito A. albopictus, were grown at 28C in RPMI medium (Gibco). All cell line media were supplemented with 10% heat-inactivated fetal calf serum (Bovogen), penicillin (100Uml1) and streptomycin (100gml1. C6/36 medium was also supplemented with 1% GlutaMax (200mM, Gibco) and 20mM HEPES (Gibco). All cell lines used in this study were tested for mycoplasma by first culturing cells for 35days in antibiotic-free medium and then subjecting them to mycoplasma testing using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).

Seven SARS-CoV-2 variants were used in this study: (1) ancestral or Wuhan strain: an early Australian isolate, hCoV-19/Australia/QLD02/2020, sampled on 30January 2020 (Global Initiative on Sharing All Influenza Data (GISAID) Accession ID: EPI_ISL_407896); (2) Alpha (B.1.1.7), named hCoV-19/Australia/QLD1517/2021 and collected on 6January 2021 (GISAID accession ID: EPI_ISL_944644); (3) Beta (B.1.351), hCoV-19/Australia/QLD1520/2020, collected on 29December 2020 (GISAID accession ID: EPI_ISL_968081); (4) Delta (B.1.617), hCoV-19/Australia/QLD1893C/2021 collected on 5April 2021 (GISAID accession ID: EPI_ISL_2433928); (5) Gamma (P.1), hCoV-19/Australia/NSW4318/2021 sampled on 1March 2021 (GISAID accession ID: EPI_ISL_1121976); (6) Lambda (C.37), hCoV-19/Australia/NSW4431/2021 collected on 3April 2021 (GISAID accession ID: EPI_ISL_1494722); and (7) Omicron (BA.1), hCoV-19/Australia/NSW-RPAH-1933/2021 collected on 27November 2021 (GISAID accession ID: EPI_ISL_6814922). All viral isolates obtained were passaged twice, except for Gamma and Lambda variants, which were passaged three times. Viral stocks were generated on TMPRSS2-expressing Vero E6 cells to ensure no Spike furin cleavage site loss. To authenticate SARS-CoV-2 isolates used in the study, viral RNA was extracted from stocks using TRIzol LS reagent (Thermo Fisher Scientific) and complementary DNA was prepared with a ProtoscriptII first-strand cDNA synthesis kit according to the manufacturers protocol (New England Biolabs). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers: CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG, CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC, under conditions previously described57. For encephalitic flaviviruses, virulent strains of ZIKV (Natal (GenBank: KU527068.1)), JEV (Nakayama strain (GenBank: EF571853.1)) and ROCV (GenBank: AY632542.4) were propagated on C6/36 to generate viral stock for all experiments. Viral titers were determined by immunoplaque assay58.

RNA from BOs and mouse tissue was extracted with the RNeasy Mini Kit (Qiagen) for mRNA detection, according to the manufacturers instructions. Mouse tissue was homogenized with a TissueLyserII (Qiagen) at 30Hz for 60s. RNA integrity of BOs and mouse tissue was evaluated by analysis on a 2100Bioanalyzer RNA6000 Pico Chip kit (Agilent) using RNA integrity number. RNA samples with RNA integrity number >7 were considered to be of sufficiently high quality for real-time quantitative PCR, and for transcriptomic library construction and RNA-seq, according to the manufacturers instructions.

Total RNA (1g) was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-Rad). A volume corresponding to 5ng of initial RNA was utilized for each real-time PCR reaction using PowerUp SYBR Green Master Mix (Applied Biosystems) on a CFX Opus Real-Time PCR detection system (data collection was performed via Bio-Rads CFX Maestro Software, v.2.3). Ribosomal protein P0 (RPLP0) was used as control transcript for normalization. Primer sequences (5'3' orientation) are listed in Supplementary Table 1.

Brain organoids on low-adhesion plates were infected overnight (14h) with the indicated flaviviruses and SARS-CoV-2 variants at MOI=0.1 and 1.0, respectively; BOs were then washed three times with lipopolysaccharide-free PBS, with the addition of maintenance medium, and maintained for 5dpi.

For infection experiments, 5days following viral exposure, BOs were treated with a single dose of either navitoclax (2.5M), ABT-737 (10M) or D+Q (D, 10M; Q, 25M) and monitored for 5days following treatment. In regard to senolytic interventions on physiologically aged 8-month-old organoids, BOs were treated with a weekly dose of either navitoclax (2.5M), ABT-737 (10M) or D+Q (D, 10M; Q, 25M) for 4weeks and subsequently collected for downstream analysis.

In vivo experiments were performed using 6-week-old K18-hACE2 transgenic female mice obtained from the Animal Resources Centre (Australia). For animal infections, SARS-CoV-2 was delivered intranasally20l of the Delta variant at 5103 focus-forming units per mouseon anesthetized mice (100mgkg1 ketamine and 10mgkg1 xylazine). Control animals were mock infected with the same volume of RPMI additive-free medium. One day following infection, K18-hACE2 mice were distributed among three treatment groups (n=16 each) and one solvent-only control group (n=16). From 1dpi, animals were treated by oral gavage with either navitoclax (100mgkg1), D+Q (D, 5mgkg1; Q, 50mgkg1) or fisetin (100mgkg1) dissolved in 5% DMSO and 95% corn oil every other day. For tissue characterization (n=8 for each infected group), at6dpi animals were euthanized and brain specimens collected for RNA expression analysis and histopathological assessment. For clinical and survival evaluation, mice were monitored daily for up to 12dpi. Clinical scoring included the following: no detectable disease (0); hindlimb weakness, away from littermates or ruffled fur (0.51.0); partial hindlimb paralysis, limping, hunched or reluctance to move (1.52.0); and complete paralysis of hindlimb, severely restricted mobility, severe distress or death (2.53.0).

Brain organoids were fixed in 4% paraformaldehyde for 1at room temperature (RT) and washed with PBS three times for 10min each at RT before being allowed to sink in 30% sucrose at 4C overnight, and were then embedded in optimal cutting temperature (OCT; Agar Scientific, no. AGR1180) and cryosectioned at 14m with a Thermo Scientific NX70 Cryostat. Tissue sections were used for both immunofluorescence and SA--gal assay. For immunofluorescence, sections were blocked and permeabilized in 0.1% Triton X-100 and 3% bovine serum albumin in PBS. Sections were incubated with primary antibodies overnight at 4C, washed and incubated with secondary antibodies for 40min at RT. DAPI (0.5gml1; Sigma, no. D9564) was added to secondary antibodies to mark nuclei. Secondary antibodies labeled with Alexafluor488, 568 or 647 (Invitrogen) were used for detection. SA--gal activity at pH6.0 as a senescence marker in fresh or cryopreserved human samples was assessed as previously described59.

OCT-embedded organoids were freshly sectioned and prepared according to the GeoMX Human Whole Transcriptome Atlas Assay slide preparation for RNA profiling (NanoString). Three organoids were used per condition for ROI selection. Fastq files were uploaded to the GeoMX DSP system, where raw and Q3-normalized counts of all targets were aligned with ROIs. The 0.75quantile-scaled data were used as input. The DESeq2 v.1.30.1R package60 was used to identify differently expressed genes in ROI cell subsets. DESeq2 was performed among pairwise comparisons of interest and genes were corrected using BenjaminiHochberg correction, with only genes with corrected P<0.05 retained. Cell abundance was estimated using the SpatialDecon v.1.10.0R library, which performs mixture deconvolution using constrained log-normal regression and infers cell distributions based on pre-existing single-cell sequencing cell type annotations. Gene expression patterns of GeoMx data were deconvolved based on a training matrix of single-cell sequencing data from the Allen Human Brain Atlas. Projected proportions of different cell types were inferred, and are explained by the overall expression patterns and cell number of each of the spatial trancriptomic regions of interest.

Before mRNA sequencing, ribosomal RNA from BO RNA was depleted using the Ribo-Zero rRNA Removal Kit (Illumina). Transcripts were sequenced at Novogene using TruSeq stranded total RNA library preparation and the Illumina NovaSeq 150-base pair, paired-end lane. FastQC was used to check the quality of raw sequences before analysis to confirm data integrity. Trimmed reads were mapped to human genome assembly hg38 using Hisat2 v.2.0.5. To ensure high quality of the count table, the raw count table generated by featureCounts v.1.5.0-p3 was filtered for subsequent analysis. Differential gene expression analysis was performed using Bioconductor DESeq2 Rpackages. The resulting Pvalues were adjusted using the BenjaminiHochberg approach for control of false discovery rate. Genes with adjusted P<0.05 found by DESeq2 were assigned as differentially expressed.

To assess the effect of senolytics on the transcriptomic age of BO samples, we applied a brain multispecies (mouse, rat, human) transcriptomic clock based on signatures of aging identified in ref. 30. Missing values were omitted with the precalculated average values from the clock. Association of gene expression log-fold change (FC) induced by senolytics in aged BO with previously established transcriptomic signatures of aging and established lifespan-extending interventions was examined, as described in ref. 30. Signatures of aging utilized included multispecies brain signature as well as multitissue aging signatures of mouse, rat and human. Signatures of lifespan-extending interventions included genes differentially expressed in mouse tissues in response to individual interventions including CR, rapamycin (Rapamycin) and mutations associated with growth hormone deficiency (GH deficiency), along with common patterns of lifespan-extending interventions (Common) and endothelial cells (ECs) associated with the intervention effect on mouse maximum (Max lifespan) and median lifespan (Median lifespan).

For identification of enriched functions affected by senolytics in aged BO, we performed functional gene set enrichment analysis (GSEA)61 on a preranked list of genes based on log10(P) corrected by the sign of regulation, calculated as

$$-({Pv})times mathrm{sgn}({I{mathrm{FC}}}),$$

where Pv and lFC are P and logFC, respectively, of a particular gene obtained from edgeR output, and sgn is the signum function (equal to 1, 1 or 0 if the value is positive, negative or equal to 0, respectively). HALLMARK ontology from the Molecular Signature Database was used as gene sets for GSEA. The GSEA algorithm was performed separately for each senolytic via the fgsea package in R, with 5,000permutations. A qvalue cutoff of 0.1 was used for selection of statistically significant functions.

Similar analysis was performed for gene expression signatures of aging and lifespan-extending interventions. Pairwise Spearman correlation was calculated for individual signatures of senolytics, aging and lifespan-extending interventions based on estimated normalized enrichment score (NES) (Fig. 2g). A heatmap colored by NES was built for manually chosen statistically significant functions (adjusted P<0.1) (Extended Data Fig. 1a). A complete list of functions enriched by genes perturbed by senolytics is included in Source data.

Immunofluorescence images were acquired using either a Zeiss LSM900 Fast Airyscan2 super-resolution microscope or a Zeiss AxioScan Z1 Fluorescent Imager. For organoid staining, the number of positive cells per organoid for senescence, cell type and viral markers tested was analyzed using the imaging software CellProfiler (v.4.2.1) and Fiji (v.2.1.0/1.53c), with the same pipeline for each sample in the same experiment. Custom Matlab R2018b (9.5.0.944444) scripts were developed to streamline high-throughput imaging data. The CellProfiler pipeline for the quantification of SA--gal-positive cells is available in Supplementary Code 1.

The following were used: anti-p16 (Cell Signalling, 1:400, no. 80772); anti-p21 (R&D Systems, 1:400, no. AF1047); anti-NeuN (Millipore, 1:1,000, no. ABN78); anti-GFAP (Agilent, 1:2,000, no. Z0334); anti-GFAP (Invitrogen, 1:1,000, no. 13-0300); anti-Sox2 (Cell Signalling, 1:1,000, no. 23064); anti-Sox2 (Cell Signalling, 1:1,000, no. 4900); anti-Sox10 (abcam, 1:500, no. ab229331); anti-Iba1 (Wako, 1:1,000, no. 019-19741); anti-SARS-CoV-2 Nucleocapsid C2, 1:1,000 (ref. 62); anti-SARS-CoV-2 Spike protein, 1:1,000 (ref. 63); anti-H2AX (Millipore, 1:1,000, no. 05-636); anti-TH (Invitrogen, 1:1,000, no. PA5-85167); anti-lamin B1 (abcam, 1:5,000, no. ab16048); anti-chicken IgG (Jackson ImmunoResearch, 1:500, no. 703-545-155); anti-rabbit IgG (Invitrogen, 1:400, no. A10042); anti-rabbit IgG (Invitrogen, 1:400, no. A21245); anti-mouse IgG (Invitrogen, 1:400, no. A11029); anti-mouse IgG (Invitrogen, 1:400, no. A21235); and anti-human IgG (Invitrogen, 1:400, no. A21445).

All experiments were performed at least two times, except for RNA-seq, mouse experiments and human postmortem analysis. For in vivo experiments, 816mice were analyzed per condition. All bar graph results are shown as means.e.m. or s.d. as indicated. No statistical methods were used to predetermine sample size, but our sample sizes are similar to those reported in previous publications19,43. Data distribution was assumed to be normal, but this was not formally tested. No data were excluded from analyses. Data collection and analysis were not performed blind to the conditions of the experiments, with the exception of mouse treatment experiments where the study investigators (E.A.A. and A.A.A.) were blinded to treatment groups by the use of color-coded drug vials generated by an independent investigator (J.A.). No randomization method was used to allocate animals or BOs to experimental groups. Pvalues were calculated by the indicated statistical tests using either R (v.3.6.0), Microsoft Excel (v.16.77) or GraphPad Prism (v.9.4.0) software. In figure legends n indicates the number of independent experiments or biological replicates.

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Read the original here:

Senolytic therapy alleviates physiological human brain aging and ... - Nature.com

Related Posts
Tags:
➤