Category: Corona Virus

Page 115«..1020..114115116117..120130..»

Senolytic therapy alleviates physiological human brain aging and … – Nature.com

November 15, 2023

Ethics and biological safety

All animal experiments were performed according to guidelines promoting the wellbeing of animals used for scientific research from The University of Queensland (UQ), and according to the Australian code for the care and use of animals for scientific purposes. The use of animals was approved by the UQ Animal Ethics Committee under project no. 2021/AE001119. Mice were housed within the BSL-3 facility using the IsoCage N-Biocontainment System (Tecniplast), where each cage was supplied with a high-efficiency, particulate-absorbing filter preventing viral contamination between cages. This IsoCage system also provides individual ventilation to the cages, maintaining humidity at <6570% and temperature 2023C. Mice were kept under a 12/12h light/dark cycle with food and water provided ad libitum.

Pathogenic SARS-CoV-2 variants and encephalitic flaviviruses were handled under certified biosafety level-3 (BSL-3) conditions at the School of Chemistry and Molecular Biosciences (SCMB), Australian Institute for Bioengineering and Nanotechnology and Institute for Molecular Bioscience at UQ. All approved researchers used disposable Tychem2000 coveralls (Dupont, no. TC198TYL) at all times and also used either powered air-purifying respirators (PAPR, SR500 Fan Unit) or Versaflopowered airpurifying respirators (3M, no. 9020399) as respiratory protection. All pathogenic materials were handled in a classII biosafety cabinet within the BSL-3 facility. For downstream analysis, all samples containing infectious viruses were appropriately inactivated in accordance with the BSL-3 manual. Liquid and solid waste were steam sterilized by autoclave. This study was approved by the Institutional Biosafety Committee from UQ under approval nos. IBC/485B/SCMB/2021 and IBC/447B/SCMB/2021. Differentiation of hPSCs into organoids and their subsequent use was approved by the UQ Institutional Research Ethics Committee under approval no. 2019000159. The WA09 PSC cell line was obtained before this study following receipt of informed consent and approval by the NIH hESC Registry (no. NIHhESC-10-0062). Analysis of human brain sections was performed with the approval of the Ethics Committee of the University of Freiburg (no. 10008/09). Consent for autopsy was provided by the individuals next of kin or healthcare proxy according to German law (participant compensation was not applicable). The study was performed in agreement with the principles expressed in the Declaration of Helsinki, 2013.

Organoid generation was carried out as previously described55, with some modifications. Human WA09 hPSCs were obtained, contamination free, from WiCell, with verified normal karyotype and were routinely tested and confirmed negative for mycoplasma (MycoAlert, Lonza). hPSCs were maintained in mTeSR medium (STEMCELL Technologies, no. 85850) on matrigel-coated plates (Corning, no. 354234). On day0 of organoid differentiation, PSCs were dissociated with Accutase (Life Technologies, no. 00-4555-56) and seeded at a density of 15,000cells per well on a 96-well, low-attachment U-bottom plate (Sigma, no. CLS7007) in mTeSR plus 10M ROCK inhibitor (VWR, no. 688000-5). The 96-well plate was then spun at 330g for 5min to aggregate the cells and create spheroids. The spheroids were fed every day for 5days in medium containing DMEM/F12 (Invitrogen, no. 11330-032), knockout serum (Invitrogen, no. 11320-033), 1:100 GlutaMax, 1:200 MEM-NEAA supplemented with dual SMAD inhibitors, 2M dorsomorphin (StemMACS, no. 130-104-466) and 2M A-83-01 (Lonza, no. 9094360). On day6, half of the medium was changed to induction medium containing DMEM/F12, 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement (Invitrogen, no. 17502048) and 1gml1 heparin (Sigma, no. H3149) supplemented with 1M CHIR 99021 (Lonza, no. 2520691) and 1M SB-431542 (Sigma, no. S4317). From day7, complete medium change was carried out with induction medium followed by daily medium change in induction medium for the next 4days. On day11 of the protocol, spheroids were transferred to 10l droplets of Matrigel on a sheet of Parafilm with 2mm dimples. These droplets were allowed to gel at 37C for 25min and were subsequently removed from the Parafilm and transferred to, and maintained in, low-attachment 24-well plates (Sigma, no. CLS3473) containing induction medium for the following 5days. From day16 the medium was then changed to organoid medium containing a 1:1 mixture of neurobasal medium (Invitrogen, no. 21103049) and DMEM/F12 medium supplemented with 1:200 MEM-NEAA, 1:100 GlutaMax, 1:100 N2 supplement, 1:50 B27 supplement (Invitrogen, no. 12587010), 1% penicillin/streptomycin (Sigma, no. P0781), 50M 2-mercaptoethanol and 0.25% insulin solution (Sigma, no. I9278). Medium was changed every other day with organoid medium. BOs were maintained in organoid medium until the end of experiments, as indicated. Microglia-containing organoid generation was carried out as previously described56 and these BOs were matured for 3months before SARS-CoV-2 exposure at MOI=1.

Frontal cortex tissue from patients that had tested positive for SARS-CoV-2 and died from severe COVID-19 was obtained at the University Medical Center Freiburg, Germany. Tissue was formalin fixed and embedded in paraffin using a Tissue Processing Center (Leica, no. ASP300). Sections (3m thick) were cut and mounted on Superfrost objective slides (Langenbrinck).

RNA Vero E6 cells (African green monkey kidney cell clones) and TMPRSS2-expressing Vero E6 cell lines were maintained in DMEM (Gibco) at 37C with 5% CO2. In addition, as previously described, the TMPRSS2-expressing Vero E6 cell line was supplemented with 30gml1 puromycin57. C6/36 cells, derived from the salivary gland of the mosquito A. albopictus, were grown at 28C in RPMI medium (Gibco). All cell line media were supplemented with 10% heat-inactivated fetal calf serum (Bovogen), penicillin (100Uml1) and streptomycin (100gml1. C6/36 medium was also supplemented with 1% GlutaMax (200mM, Gibco) and 20mM HEPES (Gibco). All cell lines used in this study were tested for mycoplasma by first culturing cells for 35days in antibiotic-free medium and then subjecting them to mycoplasma testing using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza).

Seven SARS-CoV-2 variants were used in this study: (1) ancestral or Wuhan strain: an early Australian isolate, hCoV-19/Australia/QLD02/2020, sampled on 30January 2020 (Global Initiative on Sharing All Influenza Data (GISAID) Accession ID: EPI_ISL_407896); (2) Alpha (B.1.1.7), named hCoV-19/Australia/QLD1517/2021 and collected on 6January 2021 (GISAID accession ID: EPI_ISL_944644); (3) Beta (B.1.351), hCoV-19/Australia/QLD1520/2020, collected on 29December 2020 (GISAID accession ID: EPI_ISL_968081); (4) Delta (B.1.617), hCoV-19/Australia/QLD1893C/2021 collected on 5April 2021 (GISAID accession ID: EPI_ISL_2433928); (5) Gamma (P.1), hCoV-19/Australia/NSW4318/2021 sampled on 1March 2021 (GISAID accession ID: EPI_ISL_1121976); (6) Lambda (C.37), hCoV-19/Australia/NSW4431/2021 collected on 3April 2021 (GISAID accession ID: EPI_ISL_1494722); and (7) Omicron (BA.1), hCoV-19/Australia/NSW-RPAH-1933/2021 collected on 27November 2021 (GISAID accession ID: EPI_ISL_6814922). All viral isolates obtained were passaged twice, except for Gamma and Lambda variants, which were passaged three times. Viral stocks were generated on TMPRSS2-expressing Vero E6 cells to ensure no Spike furin cleavage site loss. To authenticate SARS-CoV-2 isolates used in the study, viral RNA was extracted from stocks using TRIzol LS reagent (Thermo Fisher Scientific) and complementary DNA was prepared with a ProtoscriptII first-strand cDNA synthesis kit according to the manufacturers protocol (New England Biolabs). The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers: CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG, CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC, under conditions previously described57. For encephalitic flaviviruses, virulent strains of ZIKV (Natal (GenBank: KU527068.1)), JEV (Nakayama strain (GenBank: EF571853.1)) and ROCV (GenBank: AY632542.4) were propagated on C6/36 to generate viral stock for all experiments. Viral titers were determined by immunoplaque assay58.

RNA from BOs and mouse tissue was extracted with the RNeasy Mini Kit (Qiagen) for mRNA detection, according to the manufacturers instructions. Mouse tissue was homogenized with a TissueLyserII (Qiagen) at 30Hz for 60s. RNA integrity of BOs and mouse tissue was evaluated by analysis on a 2100Bioanalyzer RNA6000 Pico Chip kit (Agilent) using RNA integrity number. RNA samples with RNA integrity number >7 were considered to be of sufficiently high quality for real-time quantitative PCR, and for transcriptomic library construction and RNA-seq, according to the manufacturers instructions.

Total RNA (1g) was reverse transcribed using an iScript cDNA Synthesis Kit (Bio-Rad). A volume corresponding to 5ng of initial RNA was utilized for each real-time PCR reaction using PowerUp SYBR Green Master Mix (Applied Biosystems) on a CFX Opus Real-Time PCR detection system (data collection was performed via Bio-Rads CFX Maestro Software, v.2.3). Ribosomal protein P0 (RPLP0) was used as control transcript for normalization. Primer sequences (5'3' orientation) are listed in Supplementary Table 1.

Brain organoids on low-adhesion plates were infected overnight (14h) with the indicated flaviviruses and SARS-CoV-2 variants at MOI=0.1 and 1.0, respectively; BOs were then washed three times with lipopolysaccharide-free PBS, with the addition of maintenance medium, and maintained for 5dpi.

For infection experiments, 5days following viral exposure, BOs were treated with a single dose of either navitoclax (2.5M), ABT-737 (10M) or D+Q (D, 10M; Q, 25M) and monitored for 5days following treatment. In regard to senolytic interventions on physiologically aged 8-month-old organoids, BOs were treated with a weekly dose of either navitoclax (2.5M), ABT-737 (10M) or D+Q (D, 10M; Q, 25M) for 4weeks and subsequently collected for downstream analysis.

In vivo experiments were performed using 6-week-old K18-hACE2 transgenic female mice obtained from the Animal Resources Centre (Australia). For animal infections, SARS-CoV-2 was delivered intranasally20l of the Delta variant at 5103 focus-forming units per mouseon anesthetized mice (100mgkg1 ketamine and 10mgkg1 xylazine). Control animals were mock infected with the same volume of RPMI additive-free medium. One day following infection, K18-hACE2 mice were distributed among three treatment groups (n=16 each) and one solvent-only control group (n=16). From 1dpi, animals were treated by oral gavage with either navitoclax (100mgkg1), D+Q (D, 5mgkg1; Q, 50mgkg1) or fisetin (100mgkg1) dissolved in 5% DMSO and 95% corn oil every other day. For tissue characterization (n=8 for each infected group), at6dpi animals were euthanized and brain specimens collected for RNA expression analysis and histopathological assessment. For clinical and survival evaluation, mice were monitored daily for up to 12dpi. Clinical scoring included the following: no detectable disease (0); hindlimb weakness, away from littermates or ruffled fur (0.51.0); partial hindlimb paralysis, limping, hunched or reluctance to move (1.52.0); and complete paralysis of hindlimb, severely restricted mobility, severe distress or death (2.53.0).

Brain organoids were fixed in 4% paraformaldehyde for 1at room temperature (RT) and washed with PBS three times for 10min each at RT before being allowed to sink in 30% sucrose at 4C overnight, and were then embedded in optimal cutting temperature (OCT; Agar Scientific, no. AGR1180) and cryosectioned at 14m with a Thermo Scientific NX70 Cryostat. Tissue sections were used for both immunofluorescence and SA--gal assay. For immunofluorescence, sections were blocked and permeabilized in 0.1% Triton X-100 and 3% bovine serum albumin in PBS. Sections were incubated with primary antibodies overnight at 4C, washed and incubated with secondary antibodies for 40min at RT. DAPI (0.5gml1; Sigma, no. D9564) was added to secondary antibodies to mark nuclei. Secondary antibodies labeled with Alexafluor488, 568 or 647 (Invitrogen) were used for detection. SA--gal activity at pH6.0 as a senescence marker in fresh or cryopreserved human samples was assessed as previously described59.

OCT-embedded organoids were freshly sectioned and prepared according to the GeoMX Human Whole Transcriptome Atlas Assay slide preparation for RNA profiling (NanoString). Three organoids were used per condition for ROI selection. Fastq files were uploaded to the GeoMX DSP system, where raw and Q3-normalized counts of all targets were aligned with ROIs. The 0.75quantile-scaled data were used as input. The DESeq2 v.1.30.1R package60 was used to identify differently expressed genes in ROI cell subsets. DESeq2 was performed among pairwise comparisons of interest and genes were corrected using BenjaminiHochberg correction, with only genes with corrected P<0.05 retained. Cell abundance was estimated using the SpatialDecon v.1.10.0R library, which performs mixture deconvolution using constrained log-normal regression and infers cell distributions based on pre-existing single-cell sequencing cell type annotations. Gene expression patterns of GeoMx data were deconvolved based on a training matrix of single-cell sequencing data from the Allen Human Brain Atlas. Projected proportions of different cell types were inferred, and are explained by the overall expression patterns and cell number of each of the spatial trancriptomic regions of interest.

Before mRNA sequencing, ribosomal RNA from BO RNA was depleted using the Ribo-Zero rRNA Removal Kit (Illumina). Transcripts were sequenced at Novogene using TruSeq stranded total RNA library preparation and the Illumina NovaSeq 150-base pair, paired-end lane. FastQC was used to check the quality of raw sequences before analysis to confirm data integrity. Trimmed reads were mapped to human genome assembly hg38 using Hisat2 v.2.0.5. To ensure high quality of the count table, the raw count table generated by featureCounts v.1.5.0-p3 was filtered for subsequent analysis. Differential gene expression analysis was performed using Bioconductor DESeq2 Rpackages. The resulting Pvalues were adjusted using the BenjaminiHochberg approach for control of false discovery rate. Genes with adjusted P<0.05 found by DESeq2 were assigned as differentially expressed.

To assess the effect of senolytics on the transcriptomic age of BO samples, we applied a brain multispecies (mouse, rat, human) transcriptomic clock based on signatures of aging identified in ref. 30. Missing values were omitted with the precalculated average values from the clock. Association of gene expression log-fold change (FC) induced by senolytics in aged BO with previously established transcriptomic signatures of aging and established lifespan-extending interventions was examined, as described in ref. 30. Signatures of aging utilized included multispecies brain signature as well as multitissue aging signatures of mouse, rat and human. Signatures of lifespan-extending interventions included genes differentially expressed in mouse tissues in response to individual interventions including CR, rapamycin (Rapamycin) and mutations associated with growth hormone deficiency (GH deficiency), along with common patterns of lifespan-extending interventions (Common) and endothelial cells (ECs) associated with the intervention effect on mouse maximum (Max lifespan) and median lifespan (Median lifespan).

For identification of enriched functions affected by senolytics in aged BO, we performed functional gene set enrichment analysis (GSEA)61 on a preranked list of genes based on log10(P) corrected by the sign of regulation, calculated as

$$-({Pv})times mathrm{sgn}({I{mathrm{FC}}}),$$

where Pv and lFC are P and logFC, respectively, of a particular gene obtained from edgeR output, and sgn is the signum function (equal to 1, 1 or 0 if the value is positive, negative or equal to 0, respectively). HALLMARK ontology from the Molecular Signature Database was used as gene sets for GSEA. The GSEA algorithm was performed separately for each senolytic via the fgsea package in R, with 5,000permutations. A qvalue cutoff of 0.1 was used for selection of statistically significant functions.

Similar analysis was performed for gene expression signatures of aging and lifespan-extending interventions. Pairwise Spearman correlation was calculated for individual signatures of senolytics, aging and lifespan-extending interventions based on estimated normalized enrichment score (NES) (Fig. 2g). A heatmap colored by NES was built for manually chosen statistically significant functions (adjusted P<0.1) (Extended Data Fig. 1a). A complete list of functions enriched by genes perturbed by senolytics is included in Source data.

Immunofluorescence images were acquired using either a Zeiss LSM900 Fast Airyscan2 super-resolution microscope or a Zeiss AxioScan Z1 Fluorescent Imager. For organoid staining, the number of positive cells per organoid for senescence, cell type and viral markers tested was analyzed using the imaging software CellProfiler (v.4.2.1) and Fiji (v.2.1.0/1.53c), with the same pipeline for each sample in the same experiment. Custom Matlab R2018b (9.5.0.944444) scripts were developed to streamline high-throughput imaging data. The CellProfiler pipeline for the quantification of SA--gal-positive cells is available in Supplementary Code 1.

The following were used: anti-p16 (Cell Signalling, 1:400, no. 80772); anti-p21 (R&D Systems, 1:400, no. AF1047); anti-NeuN (Millipore, 1:1,000, no. ABN78); anti-GFAP (Agilent, 1:2,000, no. Z0334); anti-GFAP (Invitrogen, 1:1,000, no. 13-0300); anti-Sox2 (Cell Signalling, 1:1,000, no. 23064); anti-Sox2 (Cell Signalling, 1:1,000, no. 4900); anti-Sox10 (abcam, 1:500, no. ab229331); anti-Iba1 (Wako, 1:1,000, no. 019-19741); anti-SARS-CoV-2 Nucleocapsid C2, 1:1,000 (ref. 62); anti-SARS-CoV-2 Spike protein, 1:1,000 (ref. 63); anti-H2AX (Millipore, 1:1,000, no. 05-636); anti-TH (Invitrogen, 1:1,000, no. PA5-85167); anti-lamin B1 (abcam, 1:5,000, no. ab16048); anti-chicken IgG (Jackson ImmunoResearch, 1:500, no. 703-545-155); anti-rabbit IgG (Invitrogen, 1:400, no. A10042); anti-rabbit IgG (Invitrogen, 1:400, no. A21245); anti-mouse IgG (Invitrogen, 1:400, no. A11029); anti-mouse IgG (Invitrogen, 1:400, no. A21235); and anti-human IgG (Invitrogen, 1:400, no. A21445).

All experiments were performed at least two times, except for RNA-seq, mouse experiments and human postmortem analysis. For in vivo experiments, 816mice were analyzed per condition. All bar graph results are shown as means.e.m. or s.d. as indicated. No statistical methods were used to predetermine sample size, but our sample sizes are similar to those reported in previous publications19,43. Data distribution was assumed to be normal, but this was not formally tested. No data were excluded from analyses. Data collection and analysis were not performed blind to the conditions of the experiments, with the exception of mouse treatment experiments where the study investigators (E.A.A. and A.A.A.) were blinded to treatment groups by the use of color-coded drug vials generated by an independent investigator (J.A.). No randomization method was used to allocate animals or BOs to experimental groups. Pvalues were calculated by the indicated statistical tests using either R (v.3.6.0), Microsoft Excel (v.16.77) or GraphPad Prism (v.9.4.0) software. In figure legends n indicates the number of independent experiments or biological replicates.

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Read the original here:

Senolytic therapy alleviates physiological human brain aging and ... - Nature.com

Progress on GeoVaxs Universal Coronavirus Vaccine Candidate, GEO-CM02, Presented at Vaccines Summit 2023 – Yahoo Finance

November 15, 2023

GeoVax, Inc.

Single-Dose Protection Demonstrated Against Multiple SARS-CoV-2 Variants

ATLANTA, GA, Nov. 14, 2023 (GLOBE NEWSWIRE) -- via NewMediaWire GeoVax Labs, Inc. (Nasdaq: GOVX), a biotechnology company developing immunotherapies and vaccines against cancers and infectious diseases, today announced the presentation of preclinical vaccine efficacy data for GEO-CM02, a multi-antigen investigational SARS-CoV-2 vaccine. The data were presented during the Vaccines Summit 2023 conference, being held in Boston, MA on November 13-15, 2023. The presentation, titled MVA-vectored multi-antigen COVID-19 vaccines induce protective immunity against SARS-CoV-2 variants spanning Alpha to Omicron in preclinical animal models, was delivered by Mukesh Kumar, PhD, Associate Professor, Department of Biology, Georgia State University.

We are thrilled to continue to demonstrate the robust efficacy profile of GEO-CM02 with the presentation of preclinical data at this years Vaccine Summit, said David Dodd, GeoVaxs Chairman and CEO. Together, these data indicate that immunization with the multi-antigen GEO-CM02 vaccine can protect against severe disease and death induced by SARS-CoV-2 infection and regardless of the variant. Along with a demonstrated safety profile, we believe GEO-CM02 has potential as a transformative universal coronavirus vaccine.

First-generation SARS-CoV-2 vaccines based on the spike (S) protein have demonstrated that they induce neutralizing antibodies, providing effective, albeit short-term levels of immune protection. Unfortunately, with the existing authorized vaccines, efficacy is disrupted by emerging variants that contribute to neutralizing antibody evasion, requiring continuous updating and booster doses. To address this limitation, GeoVax is currently evaluating its dual antigen COVID-19 vaccine, GEO-CM04S1 in three Phase 2 clinical trials. GEO-CM04S1 encodes for both the spike (S) and nucleocapsid (N) antigens of SARS-CoV-2 and is specifically designed to induce both antibody and T cell responses to those parts of the virus less likely to mutate over time. The more broadly functional engagement of the immune system is designed to protect against severe disease caused by continually emerging variants of COVID-19. Vaccines of this format should not require frequent and repeated modification or updating. Moreover, GEO-CM04S1 is being developed specifically as a COVID-19 vaccine in support of patients with compromised immune systems, for whom the current authorized vaccines appear inadequate in providing protective immunity.

Story continues

GEO-CM02 is a multi-antigen SARS-CoV-2 vaccine, based on the S, membrane (M), and envelope (E) proteins, which are designed to also engage both the humoral (antibody) and cellular (T-cell) arms of the immune system and to broaden both the function and specificity, potentially as a universal coronavirus vaccine. Efficacy of this investigational vaccine was tested using the industry standard, lethal hACE2 transgenic mouse model.

Data highlights from the Vaccine Summit 2023 presentation are as follows:

The GEO-CM02 vaccine induced immune responses that were efficacious against the original Wuhan strain and BA.1 Omicron variant with a single dose.

Animals were protected prior to the detection of neutralizing antibodies, likely indicating a critical T-cell contribution.

GEO-CM02 significantly reduced or eliminated inflammation and immunopathology in the lungs of vaccinated animals.

The data generated in the GEO-CM02 studies validate GeoVaxs hypothesis that vaccines designed to induce both antibodies and T-cells to multiple viral structural proteins can address the issue of viral variation and escape from the immune system. GEO-CM02 is based on GeoVaxs MVA viral vector platform, which supports the presentation of multiple vaccine antigens to the immune system in a single dose.

GeoVaxs more advanced, next-generation COVID-19 vaccine, GEO-CM04S1, is being evaluated in three ongoing Phase 2 clinical trials:

As a primary vaccine in immunocompromised patients (with hematologic cancers receiving cell transplants or CAR-T therapy). ClinicalTrials.gov Identifier: NCT04977024. GeoVax recently announced clinical site expansion for this trial.

As a booster vaccine in immunocompromised patients with chronic lymphocytic leukemia (CLL), a recognized high-risk group for whom current mRNA vaccines and monoclonal antibody (MAb) therapies appear inadequate relative to providing protective immunity. ClinicalTrials.gov Identifier: NCT05672355.

As a booster vaccine for healthy patients who have previously received the Pfizer or Moderna mRNA vaccine. ClinicalTrials.gov Identifier: NCT04639466. GeoVax recently announced that this trial has fully enrolled.

About GeoVax

GeoVax Labs, Inc. is a clinical-stage biotechnology company developing novel therapies and vaccines for solid tumor cancers and many of the worlds most threatening infectious diseases. The companys lead program in oncology is a novel oncolytic solid tumor gene-directed therapy, Gedeptin, presently in a multicenter Phase 1/2 clinical trial for advanced head and neck cancers. GeoVaxs lead infectious disease candidate is GEO-CM04S1, a next-generation COVID-19 vaccine targeting high-risk immunocompromised patient populations. Currently in three Phase 2 clinical trials, GEO-CM04S1 is being evaluated as a primary vaccine for immunocompromised patients such as those suffering from hematologic cancers and other patient populations for whom the current authorized COVID-19 vaccines are insufficient, and as a booster vaccine in patients with chronic lymphocytic leukemia (CLL). In addition, GEO-CM04S1 is in a Phase 2 clinical trial evaluating the vaccine as a more robust, durable COVID-19 booster among healthy patients who previously received the mRNA vaccines. GeoVax has a leadership team who have driven significant value creation across multiple life science companies over the past several decades. For more information, visit our website: http://www.geovax.com.

Forward-Looking Statements

This release contains forward-looking statements regarding GeoVaxs business plans. The words believe, look forward to, may, estimate, continue, anticipate, intend, should, plan, could, target, potential, is likely, will, expect and similar expressions, as they relate to us, are intended to identify forward-looking statements. We have based these forward-looking statements largely on our current expectations and projections about future events and financial trends that we believe may affect our financial condition, results of operations, business strategy and financial needs. Actual results may differ materially from those included in these statements due to a variety of factors, including whether: GeoVax is able to obtain acceptable results from ongoing or future clinical trials of its investigational products, GeoVaxs immuno-oncology products and preventative vaccines can provoke the desired responses, and those products or vaccines can be used effectively, GeoVaxs viral vector technology adequately amplifies immune responses to cancer antigens, GeoVax can develop and manufacture its immuno-oncology products and preventative vaccines with the desired characteristics in a timely manner, GeoVaxs immuno-oncology products and preventative vaccines will be safe for human use, GeoVaxs vaccines will effectively prevent targeted infections in humans, GeoVaxs immuno-oncology products and preventative vaccines will receive regulatory approvals necessary to be licensed and marketed, GeoVax raises required capital to complete development, there is development of competitive products that may be more effective or easier to use than GeoVaxs products, GeoVax will be able to enter into favorable manufacturing and distribution agreements, and other factors, over which GeoVax has no control.

Further information on our risk factors is contained in our periodic reports on Form 10-Q and Form 10-K that we have filed and will file with the SEC. Any forward-looking statement made by us herein speaks only as of the date on which it is made. Factors or events that could cause our actual results to differ may emerge from time to time, and it is not possible for us to predict all of them. We undertake no obligation to publicly update any forward-looking statement, whether as a result of new information, future developments or otherwise, except as may be required by law.

Company Contact:

Investor Relations Contact:

Media Contact:

info@geovax.com

paige.kelly@sternir.com

sr@roberts-communications.com

678-384-7220

212-698-8699

202-779-0929

Read the original post:

Progress on GeoVaxs Universal Coronavirus Vaccine Candidate, GEO-CM02, Presented at Vaccines Summit 2023 - Yahoo Finance

The GOP congressman who leads the House’s probe of COVID-19’s origins says he won’t seek reelection – CBS News

November 15, 2023

Republican Rep. Brad Wenstrup, who leads the House GOP's investigation of the origins of COVID-19, says he won't seek reelection next year.

Wenstrup represents Ohio's 2nd Congressional District and was first elected to the House in 2012. He said in a video posted on X on Thursday that he would be stepping down to spend more time with his family.

A married father of two young children, the Cincinnati native is a doctor of podiatric medicine and colonel in the Army Reserve. As chair of the House select subcommittee on the coronavirus pandemic, Wenstrup led an inquiry into the virus' origins and the government's response.

Wenstrup, who is also a longtime member of the House Intelligence Committee, has accused U.S. intelligence of withholding key facts about its investigation into the coronavirus. Republicans on the committee last year issued a staff report arguing that there are "indications" that the virus may have been developed as a bioweapon inside China's Wuhan Institute of Virology.

U.S. officials, however, released an intelligence report in June that rejected some points raised by those who argue COVID-19 leaked from a lab, instead reiterating that American spy agencies remain divided over how the pandemic began.

Wenstrup's announcement came the same day another longtime congressman also said he would not seek reelection next year. Derek Kilmer, a Democrat who represents the 6th District in Washington, cited similar reasons as Wenstrup in reaching his decision, noting the numerous family events he has missed due to his work in the House.

Kilmer served in the Washington State legislature before he was first elected to his House seat in 2012.

They are among nearly two dozen House members to announce they won't be running again in 2024.

Read More

Read the original here:

The GOP congressman who leads the House's probe of COVID-19's origins says he won't seek reelection - CBS News

Study reveals coadministered COVID-19 and flu vaccines effective … – News-Medical.Net

November 15, 2023

In a recent study published in JAMA Network Open, researchers evaluate the effectiveness of coadministering the Pfizer-BioNTech BNT162b2 BA.4/5 bivalent coronavirus disease 2019 (COVID-19) vaccine and seasonal influenza vaccines (SIVs) as compared to administering each vaccine separately in a community setting.

Study:Estimated Effectiveness of Coadministration of the BNT162b2 BA.4/5 COVID-19 Vaccine With Influenza Vaccine. Image Credit: New Africa / Shutterstock.com

Due to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) seasonal surge and declining effectiveness of COVID-19 vaccines over time against new variants, the United States Food and Drug Administration (FDA) recently approved an Omicron-specific booster for the 2023-2024 winter season. Initially, the CDC recommended a 14-day gap between COVID-19 and flu vaccination; however, updated guidelines support simultaneous administration following safety and efficacy studies.

Nevertheless, further research is needed to evaluate the combined effectiveness of coadministered COVID-19 and flu vaccines at the community level.

The current study utilized the Optum deidentified Clinformatics Data Mart Database, which comprises a diverse population from U.S. commercial and Medicare Advantage health plans, to assess the effectiveness of coadministering BNT162b2-biv and SIVs. The study included adults over the age of 18 who were enrolled in insurance plans by August 2022 and received either of the vaccines or both between August 2022 and January 2023.

Exclusions applied to individuals with prior COVID-19 or influenza diagnosis, those who received a different COVID-19 vaccine, or those who received a second vaccine dose too soon after the first.

The researchers compared the same-day coadministration of BNT162b2-biv and SIV with their separate administration, specifically considering only enhanced SIVs for participants over 65 years of age. Vaccination statuses were identified through diverse coding systems across various healthcare settings.

Key outcomes of the study included hospitalizations, emergency department visits, and outpatient appointments, in which specific International Classification of Diseases, Tenth Revision, Clinical Modification (ICD-10-CM) diagnosis codes were used.

The study evaluated relative risks for COVID-19 and influenza outcomes by comparing groups who were coadministered vaccines with those who received these vaccines individually. Negative control outcomes included urinary tract infections and unintentional injuries to detect biases.

The researchers thoroughly examined variables, including demographics, clinical profiles, vaccination records, and health-seeking behaviors. Using logistic regression models, propensity scores and stabilized inverse probability of treatment weights (IPTWs) were generated to balance baseline characteristics. Hazard ratios for different outcomes were determined through Cox proportional hazards regression models.

A sensitivity analysis was conducted to address the effects of specific COVID-19 and influenza treatments. The research, categorized by age groups, refrained from formal statistical significance testing, relying instead on SAS and R for data analysis. The follow-up phase of the study began 15 days after vaccination and continued until predefined endpoints were reached.

In a study using the Optum deidentified Clinformatics Data Mart Database, 3,442,996 individuals met the criteria for analysis, with a mean age of 65 years. Among those aged 65 and older, 17.3% received both vaccines, with a higher percentage of women and many having a Charlson Comorbidity Index score of two or higher. The BNT162b2-biv vaccine was predominantly administered in retail pharmacies, whereas SIV administration was more evenly divided between offices and pharmacies.

In those between 18 and 64 years of age, the prevalent SIVs were egg- and cell-based standard-dose types. The application of IPTWs achieved a balance in covariates, although discrepancies remained in the geographic region and the month of the index date. The median follow-up duration varied among the groups, with the longest being 109 days for older participants receiving coadministered vaccines.

Upon examining COVID-19-related outcomes, all groups exhibited generally low incidence rates. Notably, those in the coadministration group experienced similar or marginally increased rates of COVID-19 outcomes as compared to those receiving only a single vaccine at once.

The assessment of negative control outcomes revealed minimal bias. By calibrating the results with these outcomes, the risk estimates were adjusted closer to neutral, thus enhancing the reliability of the findings.

Regarding influenza-related outcomes, the coadministration group, particularly those 65 years of age and older, was associated with a lower incidence of all influenza-related outcomes as compared to the SIV-only group. This pattern was consistent in the younger age group, with most confidence intervals crossing 1.00 after calibration with negative control outcomes.

Sensitivity analyses, which included censoring for COVID-19 or influenza treatment and requiring a primary position diagnosis code for hospitalization, showed similar results across all outcomes and age groups.

Journal reference:

Visit link:

Study reveals coadministered COVID-19 and flu vaccines effective ... - News-Medical.Net

Parental Hesitancy and Attitude Concerning COVID-19 Vaccine and … – Cureus

November 15, 2023

Specialty

Please choose I'm not a medical professional. Allergy and Immunology Anatomy Anesthesiology Cardiac/Thoracic/Vascular Surgery Cardiology Critical Care Dentistry Dermatology Diabetes and Endocrinology Emergency Medicine Epidemiology and Public Health Family Medicine Forensic Medicine Gastroenterology General Practice Genetics Geriatrics Health Policy Hematology HIV/AIDS Hospital-based Medicine I'm not a medical professional. Infectious Disease Integrative/Complementary Medicine Internal Medicine Internal Medicine-Pediatrics Medical Education and Simulation Medical Physics Medical Student Nephrology Neurological Surgery Neurology Nuclear Medicine Nutrition Obstetrics and Gynecology Occupational Health Oncology Ophthalmology Optometry Oral Medicine Orthopaedics Osteopathic Medicine Otolaryngology Pain Management Palliative Care Pathology Pediatrics Pediatric Surgery Physical Medicine and Rehabilitation Plastic Surgery Podiatry Preventive Medicine Psychiatry Psychology Pulmonology Radiation Oncology Radiology Rheumatology Substance Use and Addiction Surgery Therapeutics Trauma Urology Miscellaneous

See the article here:

Parental Hesitancy and Attitude Concerning COVID-19 Vaccine and ... - Cureus

Reported coronavirus cases continue to drop in Attleboro area and … – The Sun Chronicle

November 15, 2023

The number of reported coronavirus cases fell locally and statewide in the week ending Nov. 4.

Statewide, the number of reported cases dropped 284, from 1,735 to 1,451, which is 16%.

And, in The Sun Chronicle 10-community area, they fell from 41 to 35, which is 14%.

The numbers are not, however, accurate because of the prevalence of home testing kits. Not all the positive cases found through those kits are reported because the intensity of the disease has lessened. Also, many people who become ill dont even bother testing.

For context, the highest number of reported new cases statewide for one week was recorded on Jan. 14, 2022, at 132,557.

The highest number locally for one week was 3,463 recorded on Jan. 13, 2022.

All told, since the beginning of the pandemic in March 2020, the area has recorded 49,283 cases.

In the week ending Nov. 4, the reported case counts in the communities was as follows:

Statewide, the number was 1,451 confirmed cases with 522 probable cases for a total of 2,079,650 cases.

The number of confirmed deaths statewide was 21 and the number of probable deaths was six for the week ending Nov. 4.

The number of confirmed deaths statewide since the beginning of the pandemic in March 2020 is 22,977 and the number of confirmed and probable deaths is 25,684.

No poll for the area has been taken recently, but the last known death total caused by the virus for the area was 456.

Most of the cases reported in the area are believed to be caused by the EG.5 variant which is a much weaker version of the original virus that plagued the nation and the world in March 2020.

Another variant has also emerged.

Its known as the BA.2.86 version of coronavirus.

George W. Rhodes can be reached at 508-236-0432.

Read the original:

Reported coronavirus cases continue to drop in Attleboro area and ... - The Sun Chronicle

U.S. Supreme Court wont hear COVID vaccine case filed by N.J. nurses – NJ.com

November 15, 2023

The U.S. Supreme Court has declined to hear an appeal filed by four New Jersey nurses over the states COVID-19 vaccine mandate for health care workers.

Even though the mandate has since been rescinded, a 2022 lawsuit brought by four nurses from Hunterdon Medical Center was still winding its way through the court system. The nurses had challenged the constitutionality of three of Gov. Phil Murphys executive orders requiring health care workers in New Jersey be immunized.

But the Supreme Court announced Monday that it wouldnt hear the appeal, allowing a lower courts ruling to stand.

The lawsuit was filed by Katie Sczesny, Jamie Rumfield, Debra Hagen and Mariette Vitti, all nurses from the Flemington hospital, who claimed the mandate violated their constitutional rights.

The executive orders signed last year (and lifted earlier this year) were at the center of the case. They required those working in health care and high-risk congregate settings to be up to date with COVID-19 vaccinations, including a first booster shot. Workers also had to show proof of vaccination.

The nurses filed an injunction aiming to block the hospital from enforcing the mandate, but that was ultimately denied by a U.S. District Court judge in June 2022 because the nurses failed to demonstrate the policy violated their constitutional rights, according to a report by the New Jersey Business and Industry Association.

By the time the case reached the 3rd U.S. Circuit Court of Appeals, the matter was ruled moot because the mandate had already been lifted.

Our journalism needs your support. Please subscribe today to NJ.com.

Spencer Kent may be reached at skent@njadvancemedia.com.

Read the rest here:

U.S. Supreme Court wont hear COVID vaccine case filed by N.J. nurses - NJ.com

Plasma SCFAs infection after COVID-19 vaccination | JIR – Dove Medical Press

November 15, 2023

Introduction

Since December 2019, the spread of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has become a major public health threat affecting human health. Pneumonia is the main manifestation of SARS-CoV-2 infection. COVID-19 patients may have a fever, cough, dyspnea, and even multiple organ dysfunction. Now it is known that the imbalance of immune response is the essence of COVID-19, also one of the main reasons for the poor progress and prognosis of severe COVID-19 patients.1,2

According to research findings, SARS-CoV-2 can invade almost all immune cells, which leads to abnormal immune responses. SARS-CoV-2 can induce the over-activation of monocyte-macrophages and dendritic cells, as well as a large amount of apoptotic T lymphocytes, resulting in the imbalance of innate and adaptive immune responses.3 The cytokine storm generated after the over-activation of the immune system causes inflammation from local to systemic, which seriously threatens the life of patients.4 In addition, SARS-CoV-2 infection can also cause a decrease in the diversity of intestinal flora,5 especially a decrease in the abundance of SCFAs-producing intestinal flora. The gut microbiota produces SCFAs upregulates anti-inflammatory cytokines and downregulates pro-inflammatory cytokines through different mechanisms, maintaining mucosal homeostasis. Once this homeostasis is disrupted, normal lymphocyte differentiation will be inhibited.6 Therefore, it is of great value to fully understand the changes in immune function in COVID-19 patients to understand its pathophysiological process and find effective treatment methods.

In this study, we recruited 83 newly diagnosed COVID-19 patients, tested the levels of peripheral blood lymphocyte subsets and cytokines using flow cytometry (FCM), and analyzed their correlation with disease severity. Further, targeted metabolomics was used to detect the changes in SCFAs level in plasma to fully clarify the characteristics of adaptive immune cell distribution in COVID-19 patients and understand its pathogenesis.

This study recruited eighty-three patients who were hospitalized in the Second Hospital of Shanxi Medical University due to SARS-CoV-2 infection from December 29, 2022, to January 6, 2023. The inclusion criteria included: SARS-CoV-2 reverse transcription polymerase chain reaction was positive, computerized tomography (CT) is characterized by the ground-glass lesions of the lung, and antibiotics and probiotics were not used within 3 months before hospitalization. The clinical classification is based on the diagnosis and treatment plan for COVID-19:7 1) moderate type: fever, cough, and shortness of breath, and the imaging shows characteristic pneumonia; 2) severe type: respiratory rate (RR) 30 per minute, oxygen saturation 93%, arterial partial pressure of oxygen (PaO2)/oxygen concentration (FiO2) 300 mmHg; 3) critical type: respiratory failure and mechanical ventilation are required, and shock or other organ failure are required to be treated in the intensive care unit. Thirty-nine age- and sex-matched community residents who have never been infected with SARS-CoV-2 and have not used antibiotics and probiotics in recent 3 months were recruited as controls. All subjects have completed a full course of vaccination against SARS-CoV-2. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). It was approved by the Ethics Committee of the Second Affiliated Hospital of Shanxi Medical University (number: 2022-KY-063). Written informed consent was obtained from all participants before the study.

Clinical parameters of patients were collected, including age, sex, duration of disease, clinical symptoms, body mass index (BMI), smoking history, chronic disease history, treatments, outcome, and so on. Laboratory data include blood routine examination [white blood cell (WBC), red blood cell (RBC), hemoglobin, platelet, neutrophile, lymphocyte, monocyte, eosinophil, basophilic] liver function test [alanine transaminase (ALT), aspartate aminotransferase (AST); serum total protein (TP); albumin (ALB), globulin (GLO)], renal function test [urea, creatinine (Cr), lactate dehydrogenase (LDH), hydroxybutyrate dehydrogenase (HBDH)], coagulation function test [prothrombin time (PT), prothrombin activity (PTA), fibrinogen (FIB), D-dimer], markers of myocardial damage [myoglobin, N-terminal pro-Brain natriuretic peptide (NT-proBNP, high-sensitivity cardiac troponin I (hs-cTnI)], procalcitonin (PCT), C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR).

Peripheral whole blood samples of patients were collected on an empty stomach in the morning within 24 hours of hospitalization. Lymphocyte subsets, including CD3+CD19 T cells, CD3CD19+ B cells, CD3+CD4+ T cells, CD3+CD8+ T cells, CD3CD16/CD56+ natural killer (NK) cells, CD4+CD8+ T cells, CD4CD8 T cells, CD4+IFN-+ T-helper (Th) 1 cells, CD4+IL-4+ Th2 cells, CD4+IL-17+ Th17 cells, and CD4+CD25+Foxp3+ regulatory T (Treg) cells, were detected using BD-FACS-CANTO II flow cytometry (Becton, Dickinson and Co., Franklin Lakes, NJ, USA).

Collect venous blood samples with a test tube containing separation gel, and retain plasma after centrifugation. Detection of cytokines soluble interleukin 2 receptor (sIL-2R), interleukin (IL)-2, IL-4, IL-6, IL-10, IL-17, tumor necrosis factor- (TNF-) and interferon- (IFN-) by human Th1/Th2/Th17 cytokine kit (Jiangxi Cellgene Biotechnology Co., Ltd China). The sample is processed according to the manufacturers specifications, and the data returned by FCAP ArrayTM v 3.0.1 software is the median fluorescence intensity (MFI) and concentration (pg/mL).

The detection of SCFAs was performed on an AB Sciex Triple Quad 4500MD mass spectrometer coupling a JasperTM high performance liquid chromatography (HPLC) system.

The venous blood was collected in the test tube containing heparin sodium and centrifuged at 3000 r for 15 minutes. 25ul sample, quality control sample and standard sample are added into the EP tube respectively. Add 10 L 1g/mL IS aqueous solution, 10 L 1M EDC and 10 L 1M O-BHA, and then mix the sample at 1000 rpm for 60 minutes. Add 50 L Milli-Q water and 400 L ethyl acetate to each sample and mix well. Take 200 L upper solution, dry for 20 minutes, and reconstituted with 100 L Milli-Q water. The injection volume is 5 L for LC-MS analysis.

The analytes were separated on a Kinetex Evo C18 analytical column (1002.1 mm 2.6m; Phenomenex), which were maintained at 40C using a mobile phase of 0.1% aqueous formic acid and methanol at a flow rate of 0.6 mL/min. The volume of injection was 5L and the analytical run time was 7.5 minutes. The gradient elution was 01.0min, 45% B; 1.05.0min, 4580% B; 5.06.5min, 80% B; 6.56.7 min, 8045% B; and 6.77.5min, 45% B. Under mass spectrometry conditions, the electrospray ionization interface (ESI) in the positive ion mode with multiple reaction monitoring (MRM) was used for detection using the following parameters: ion source temperature=500C; ion spray voltage=4500V; curtain gas (nitrogen)= 30psi; atomizing gas (GS 1)=60psi; auxiliary gas (GS 2)=60psi.

SPSS 25.0 (IBM Corp., Armonk, NY, USA) or GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA) was used for statistical analysis. Normally distributed variables were expressed as means standard deviation (M SD), and nonparametric variables were expressed as medians and interquartile range (IQR). Chi-square test, MannWhitney U-test or independent-sample T test was used to compare two groups, KruskalWallis test or one-way ANOVA was used for ex-post hoc comparisons compare of various indicators among moderate, severe, and critical. Spearman correlation test was used to evaluate the correlation between indicators. P < 0.05 was considered statistically significant.

A total of 83 COVID-19 patients (35 females; mean age: 75.27 10.55 years) and 39 non-COVID-19 people (20 females; mean age: 70.33 8.80 years) were included in this study (Table 1).In the COVID-19 group, 49 (59.0%) patients had cardiovascular diseases, 24 (28.9%) had endocrine diseases, 9 (10.8%) had respiratory diseases, 3 (3.6%) had kidney diseases, 14 (16.9%) had autoimmune diseases, and 4 (4.8%) had malignant tumors, which were consistent with those in the non-COVID-19 group (p>0.05). Compared with the non-COVID-19 group, the COVID-19 group exhibited lower levels of WBC (p=0.008), RBC (p=0.017), platelet (p<0.001), lymphocytes (p<0.001), monocytes (p=0.002), eosinophils (p<0.001) and basophils (p<0.001). Liver and kidney function indicators such as ALT (p=0.014), AST (p<0.001), LDH (p<0.001), and HBDH (p<0.001) were higher in the COVID-19 group, while TP (p=0.007) and ALB (p=0.001) were decreased. Coagulation function indexes such as FIB (p<0.001) and D-dimer (p=0.019) and inflammatory indexes ESR (p=0.001) and CRP (p=0.001) were significantly increased in the COVID-19 group.

Table 1 Comparisons of the Demographic, Clinical, and Laboratory Features Between the COVID-19 Group and the Non-COVID-19 Group

To compare the changes in immune function between the COVID-19 group and the non-COVID-19 group, we detected the absolute numbers of lymphocyte subsets using flow cytometry. Compared with the non-COVID-19 group, COVID-19 group showed that the absolute number of peripheral lymphocyte subsets was significantly reduced, including CD3+ T cells (p<0.001), CD19+ B cells (p<0.001), CD4+ T cells (p<0.001), CD8+ T cells (p<0.001), NK cells (p<0.001), CD4+CD8+ T cells (p<0.001) and CD4CD8 T cells (p<0.001) (Figure 1A). Further analysis of CD4+ T lymphocyte subsets showed that the absolute number of Th1, Th2, Th17 and Treg cells in the COVID-19 group was significantly lower than that in the non-COVID-19 group (both p<0.001) (Figure 1B), and the ratio of Th1/Th2 decreased (p=0.033), and Th2/Treg increased (p<0.001) (Figure 1D). In addition, we also measured the lymphocyte-related cytokines (Figure 1C). The results showed that the levels of sIL-2R (p=0.010), IL-6 (p=0.040) and IL-10 (p<0.001) in the COVID-19 group were significantly higher than those in the non-COVID-19 group.

Figure 1 Levels of peripheral lymphocyte subsets of COVID-19 patients. (A) Absolute numbers of lymphocyte subsets in COVID-19 group and non-COVID-19 group. (B) Absolute numbers of CD4+ T lymphocyte subsets in the two groups. (C) CD4+ T lymphocyte subsets-related cytokines in the two groups. (D) Ratio of CD4+ T lymphocyte subsets in the two groups. Data were presented as median (IQR) and were analyzed by the MannWhitney U-test.

As an important metabolite of intestinal microorganisms, SCFAs play an important role in intestinal and immune homeostasis. We used targeted metabonomics to detect the concentration of SCFAs in the plasma of the COVID-19 group and non-COVID-19 group (Figure 2). The level of SCFAs in the plasma of COVID-19 patients was low, especially propanoic acid (PA) (p=0.004), butyric acid (BA) (p<0.001), isobutyric acid (IBA) (p<0.001) and isocaproic acid (ICA) (p<0.001).

Figure 2 Comparison of SCFAs in plasma between COVID-19 group and non-COVID-19 group. Data were presented as median (IQR) and were analyzed by the MannWhitney U-test.

Abbreviations: PA, propanoic acid; BA, butyric acid; IBA, isobutyric acid; 2-MBA, 2-methylbutyric acid; ICA, isocaproic acid; CA, caproic acid.

According to the severity of the disease, we divided COVID-19 patients into three clinical types: moderate (n=34, 17 females; mean age: 70.53 11.14 years), severe (n=33, 12 females; mean age: 76.55 9.68 years) and critical (n=16, 6 females; mean age: 80.54 7.14 years) (Table 2). There is no gender difference among the three groups (p=0.483), and there is no significant difference in the disease duration (p=0.757), BMI (p=0.620), and the proportion of patients with chronic diseases (both p>0.1). Critical and severe patients were older than moderate (p=0.001, p=0.031, respectively), and the smoking rate of severe patients was higher than that of moderate (p=0.014). The neutrophil count of critical patients was significantly higher than that of severe (p=0.043), but the lymphocyte count was the lowest among the three groups, although there was no statistical difference. There were similar concentrations of ALT and AST among the three groups, but TP and ALB were significantly decreased in the critical, and far lower than those in the moderate patients (p=0.008, p=0.002, respectively). The urea level of critical patients was higher than that of moderate (p=0.010) and severe (p=0.007), but there was no difference in Cr. In coagulation function, PT and d-dimer in critical patients were significantly higher than those in moderate (p=0.029, p=0.037, respectively) and severe (p=0.005, p=0.021, respectively), and PTA was significantly reduced (p=0.007). In addition, myoglobin (p=0.016), NT-proBNP (p=0.001), and hs-cTnI (p=0.006) in critical patients are significantly higher than those in moderate, which may be related to the presence of viral myocarditis or cardiac failure. The level of PCT in critical patients was significantly higher than that in moderate (p=0.043), and ESR and CRP also showed an increasing trend.

Table 2 Comparison of Demographic, Clinical and Laboratory Features of COVID-19 Patients with Different Clinical Types

We analyzed the levels of lymphocyte subsets and related cytokines in moderate, severe and critical COVID-19 patients (Figure 3). The results showed that the damage to immune function in critical patients was more serious. Compared with moderate patients, the absolute number of CD3+ T cells in severe (p=0.005) and critical (p=0.036) was significantly lower. The level of CD19+ B cells in severe patients was significantly lower than that in moderate (p=0.001). There was no statistical difference in the absolute number of CD4+ T cells and CD8+ T cells among the three groups, but it was the lowest in the critical patients. CD4+CD8+ T cells in critical patients were significantly lower than those in moderate (p=0.026), and CD4CD8 T cells were significantly lower than those in severe (p=0.043). In the CD4+ T cell subsets, the absolute number of Th1 and Treg cells and the ratio of Th1/Th2 in critical patients were significantly lower than those in moderate (p=0.009, p=0.039, p=0.007, respectively). In terms of cytokines, IL-6 was significantly increased in severe patients, and sIL-2R and IL-10 showed an increasing trend.

Figure 3 Immune characteristics of moderate, severe and critical COVID-19 patients. (A) Absolute numbers of lymphocyte subsets in COVID-19 patients with different clinical types. (B) Absolute numbers of CD4+ T lymphocyte subsets in the three groups. (C) CD4+ T lymphocyte subsets-related cytokines in the three groups. (D) Ratio of CD4+ T lymphocyte subsets in the three groups. Data were presented as median (IQR) and were analyzed by the KruskalWallis test.

To determine whether the level of SCFAs is related to the severity of the disease, we compared the plasma concentrations of SCFAs in COVID-19 patients with different clinical types (Figure 4). From the results, we can see that there is no statistical difference among the three groups in these SCFAs, but the concentration of PA and BA in severe patients is lower than that in moderate, and the concentration of PA, BA and caproic acid (CA) in critical patients is the highest in the three groups.

Figure 4 Comparison of SCFAs in plasma among moderate, severe and critical COVID-19 patients. Data were presented as median (IQR) and were analyzed by the KruskalWallis test.

To clarify the relationship between SCFAs and immune cells, we conducted a correlation analysis between them (Figure 5). PA, BA, 2-methylbutyric acid (2-MBA), IBA and CA have no significant correlation with immune cells and related cytokines. ICA was positively correlated with CD3+ T cells (r=0.421, p<0.001), CD4+ T cells (r=0.370, p=0.001), CD8+ T cells (r=0.460, p<0.001), CD4+CD8+T cells (r=0.301, p=0.006), Th1 cells (r=0.401, p<0.001), Th2 cells (r=0.370, p<0.001), Treg cells (r=0.358, p<0.001), and IL-6 (r=0.309, p=0.004).

Figure 5 Correlation heat map of SCFAs and immune cells and cytokines in COVID-19 patients. * = p<0.05, ** = p<0.01, *** = p<0.001 by Spearman correlation test.

In this study, 4 patients were followed up, and peripheral lymphocyte subsets were detected after 1 week of treatment (Figure 6). After a week of standard treatment, the absolute number of CD3+ T cells (p=0.006), CD19+ B cells (p=0.016), CD4+ T cells (p=0.001) and CD8+ T cells (p=0.025) in 4 patients increased significantly after treatment. Th17 cells (p=0.012) and Treg cells (p=0.048) were mainly elevated in CD4+ T lymphocyte subsets.

Figure 6 Changes of immune cells in COVID-19 patients before and after treatment. (A) The changes of absolute numbers of lymphocyte subsets in COVID-19 patients before and after treatment. (B) The changes of absolute numbers of CD4+ T lymphocyte subsets in COVID-19 patients before and after treatment. Data were analyzed by the matched t-test.

The normal functioning of the immune system is crucial for the body to resist viral infection. Innate immunity is the first line of defense against infection. In the early stage of SARS-CoV-2 infection, effector cells involved in innate immunity can be rapidly mobilized, effectively controlling the number and scale of pathogens.8 In COVID-19 patients, the epithelial cells of the nasopharyngeal mucosa present neutrophil and monocyte infiltration, while infected epithelial cells secrete chemokines such as CXCL1, CXCL3, CXCL6, CXCL15, CXCL16, and CXCL17.9 Inflammatory macrophages in the lungs of critical patients can further promote the recruitment and differentiation of neutrophils and monocytes, ultimately leading to the excessive inflammatory response.10 In our study, we observed a decrease in NK cells, monocytes, eosinophils, and basophils in patients with COVID-19, which may be related to the presence of immune failure in the patient.11 SARS-CoV-2 infection leads to depletion of lymphocyte and suppresses of immune function, which may be a potential immunological mechanism for the occurrence and development of COVID-19.12

Not only innate immunity, once infected with SARS-CoV-2, adaptive immunity mediated by T and B cells also quickly exerts protective effects.13 An adaptive immune response usually occurs four days after infection. If the body does not produce an effective adaptive antiviral response in a timely manner, the innate immune response will strengthen, leading to the uncontrolled release of inflammatory cytokines.14 It takes longer for elderly and chronic disease patients to produce an effective adaptive immune response. Relying on early infection to strengthen the innate antiviral immune response can lead to the occurrence of cytokine storms, increasing the risk of severe illness.15,16

Vaccination has a significant protective effect on the entire population, especially the elderly and prepares for the rapid memory response of subsequent exposure to induce neutralizing antibodies.17 Mass vaccination of COVID-19 vaccine has become a key measure for countries to fight against the epidemic.18 In addition to traditional inactivated vaccine and adenovirus vector vaccine, mRNA vaccine has also received global attention.19 After inoculation of the COVID-19 vaccine, innate immunity and adaptive immunity were widely activated, including a significant increase in the proportion of CD16+ monocytes, the activation of CD4+ T cells and CD8+ T cells, and the level of neutralizing antibodies.20 For the elderly COVID-19 patients who are likely to develop severe and critical diseases, the protection rate of 23 doses of inactivated vaccine still reaches 90.15%.21 Although vaccination can significantly reduce the severity rate and mortality rate of COVID-19 patients,22 their immune function is still damaged to a certain extent, mainly manifested by the reduction of lymphocytes and the increase of cytokines.23 In this study, COVID-19 patients not only had a decrease in innate immune cells, but also had a significant decrease in adaptive immune cells, including CD19+ B cells, CD4+ T cells, and CD8+ T cells. CD3+ T cells, CD4+CD8+ T cells, and CD4CD8 T cells showed lower levels in critical patients.

B lymphocytes exert immune effects by proliferating and differentiating into plasma cells to produce specific antibodies.24 In the early stage, T cells play a key role in durable antiviral protection.25 We further analyzed CD4+ T lymphocyte subsets and found that Th1, Th2, Th17 and Treg cells in COVID-19 patients were significantly reduced, of which Th1 and Treg cell reduction was more serious in critical patients. As an immunosuppressive cell subset, the decrease in the number of Treg promotes the occurrence of cytokine storms and inflammatory reactions.26 Cytokine storms are an important cause of death in severe and critical illnesses. Many studies have found that there are higher levels of IL-2, IL-7, IL-10, granulocyte colony-stimulating factor (G-CSF), IFN-, Inducible protein-10 (IP-10), monocyte chemokine protein-1 (MCP-1), macrophage inflammatory protein-1A (MIP-1A), and TNF- in the plasma of severe and critical COVID-19 patients.4 In our study, we also found significant increases in sIL-2R, IL-6, and IL-10 in COVID-19 patients, with the increase in IL-6 being more pronounced in severe patients.

The gastrointestinal tract is the largest immune organ in the human body. The intestinal flora and intestinal mucosa together constitute an immune barrier in the intestine. It has been reported that SARS-CoV-2 infection can change the structure of intestinal flora, mainly manifested in the reduction of beneficial symbiotic bacteria and the enrichment of conditionally pathogenic bacteria. Compared with the control group, COVID-19 patients had lower levels of intestinal bacteria such as Eubacteriaceae, Fecal Bacilliaceae, Rosebacilliaceae, Bifidobacteriaceae and Trichospiriaceae.5 In addition, the composition of intestinal flora in COVID-19 patients was analyzed by shotgun metagenome sequencing technology,27 and the data showed that the main characteristics of patients with COVID-19 were the loss of Bifidobacterium adolescentis, Ruminococcus bromii and Faecalibacterium prausnitzii, and the enrichment of Bacteroides ovatus, Bacteroides dorei, and Bacteroides thetaiotaomicron. Another study also confirmed that compared with the healthy controls, the microbial diversity in the mouth and feces of COVID-19 patients was significantly reduced.28 SCFAs are important metabolites of intestinal microorganisms, which can regulate the functions of natural immune cells such as macrophages, neutrophils, and dendritic cells and participate in immune responses. Studies have shown that SCFAs can enhance immune cell function and improve mitochondrial homeostasis, contributing to the adjuvant treatment of autoimmune diseases.29 SCFAs, especially BA, can promote the production of IL-22 by CD4+ T cells and innate lymphoid cells (ILC) by activating G-protein coupled receptor 41 (GPR41) and inhibiting histone deacetylase, thereby alleviating colitis in mice.30 For COVID-19, SCFAs, the active metabolite of intestinal symbiotic bacteria, can not only reduce the pathway of COVID-19 entering the human body by reducing the expression of angiotensin-converting enzyme 2 (ACE2) but also enhance antiviral immunity.31 SCFAs can reduce the transcription levels of important genes that control virus entry and replication, including retinoic acid-inducible gene 1 (RIG1), transmembrane protease serine 2 (TMPRSS2), and interferon (IFN) receptors while maintaining intestinal cell permeability.32 They can also regulate the differentiation of T and B cells and antigen-specific adaptive immunity.33 Our data show that plasma SCFAs in COVID-19 patients are significantly lower than those in non-COVID-19 patients, which may be related to a decrease in the bacterial population that produces SCFAs. Moreover, we have found that there is a trend towards an increase in plasma SCFAs in critical patients, which may be related to the severe damage to liver function in patients, resulting in the inability of SCFAs to undergo oxidative decomposition in the liver and their massive release into the blood. Interestingly, we found no significant correlation between the concentration of plasma SCFAs and the absolute number of immune cells, except for ICA. However, there are currently few reports on the role of plasma ICA in regulating immune cell levels.

However, the limitations of this study should be pointed out. The first is the limited sample size of the study. Secondly, most patients did not receive further interviews from us. In addition, as an observational study, we cannot indicate whether SCFAs in the plasma directly lead to changes in lymphocyte subsets in patients. Therefore, we should conduct further multicenter studies to determine the changes in the intestinal flora and their impact on immune cells in COVID-19 patients. This may help to provide a new target for the treatment of COVID-19.

In summary, this study indicates that immune function in COVID-19 patients after vaccination is still severely disrupted. The levels of plasma SCFAs are related to the level of some lymphocyte subsets and play an important role in immune regulation. It may be used as an immune modulator in the adjuvant treatment of COVID-19.

The research article data used to support the findings of this study are available from the corresponding author upon request.

The study was approved by the Ethics Committee of the Second Affiliated Hospital of Shanxi Medical University (number: 2022-KY-063).

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

This work was supported by the Scientific Research Project of Health commission of Shanxi Province (2019044), the Research Project Supported by Shanxi Scholarship Council of China (2020-191), the Science and Technology Innovation Project of Shanxi Province (2020SYS08), the Project of Central Guides Local Science and Technology Development Funds (YDZJSX2022C031) and the Foundation of Shanxi Key Laboratory for immunomicroecology (202104010910012).

The authors declare that there is no conflict of interest regarding the publication of this article.

1. Zhang B, Zhou X, Zhu C, et al. Immune Phenotyping Based on the Neutrophil-to-Lymphocyte Ratio and IgG Level Predicts Disease Severity and Outcome for Patients With COVID-19. Front Mol Biosci. 2020;7:157. doi:10.3389/fmolb.2020.00157

2. Liang W, Liang H, Ou L, et al.; China Medical Treatment Expert Group for COVID-19. Development and Validation of a Clinical Risk Score to Predict the Occurrence of Critical Illness in Hospitalized Patients With COVID-19. JAMA Intern Med. 2020;180(8):10811089. doi:10.1001/jamainternmed.2020.2033

3. Shah VK, Firmal P, Alam A, Ganguly D, Chattopadhyay S. Overview of immune response during SARS-CoV-2 infection: lessons from the past. Front Immunol. 2022;11:1949. doi:10.3389/fimmu.2020.01949

4. Huang C, Wang Y, Li X, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395(10223):497506. doi:10.1016/S0140-6736(20)30183-5

5. Zuo T, Zhang F, Lui GCY, et al. Alterations in gut microbiota of patients with COVID-19 during time of hospitalization. Gastroenterology. 2020;159(3):944955.e8. doi:10.1053/j.gastro.2020.05.048

6. Martin-Gallausiaux C, Marinelli L, Blottire HM, Larraufie P, Lapaque N. SCFA: mechanisms and functional importance in the gut. Proc Nutr Soc. 2021;80(1):3749. doi:10.1017/S0029665120006916

7. National Health Commission of the Peoples Republic of China. Diagnosis and treatment plan for COVID-19 (trial version 10). Chin J Clin Infect Dis. 2023;16(1):19. doi:10.3760/cma.j.issn.1674-2397.2023.01.001

8. Schultze JL, Aschenbrenner AC. COVID-19 and the human innate immune system. Cell. 2021;184(7):16711692. doi:10.1016/j.cell.2021.02.029

9. Chua RL, Lukassen S, Trump S, et al. COVID-19 severity correlates with airway epithelium-immune cell interactions identified by single-cell analysis. Nat Biotechnol. 2020;38(8):970979. doi:10.1038/s41587-020-0602-4

10. Liao M, Liu Y, Yuan J, et al. Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19. Nat Med. 2020;26(6):842844. doi:10.1038/s41591-020-0901-9

11. Arunachalam PS, Wimmers F, Mok CKP, et al. Systems biological assessment of immunity to mild versus severe COVID-19 infection in humans. Science. 2020;369(6508):12101220.

12. Guo Z, Zhang Z, Prajapati M, Li Y. Lymphopenia Caused by Virus Infections and the Mechanisms Beyond. Viruses. 2021;13(9):1876. doi:10.3390/v13091876

13. Priyanka P, Choudhary OP, Singh I. Protective immunity against COVID-19: unravelling the evidences for humoral vs. cellular components. Travel Med Infect Dis. 2021;39:101911. doi:10.1016/j.tmaid.2020.101911

14. Karki R, Kanneganti TD. Innate immunity, cytokine storm, and inflammatory cell death in COVID-19. J Transl Med. 2022;20(1):542. doi:10.1186/s12967-022-03767-z

15. Wang D, Hu B, Hu C, et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA. 2020;323(11):10611069. doi:10.1001/jama.2020.1585

16. Datta PK, Liu F, Fischer T, Rappaport J. SARS-CoV-2 pandemic and research gaps: understanding SARS-CoV-2 interaction with the ACE2 receptor and implications for therapy. Theranostics. 2020;10(16):74487464. doi:10.7150/thno.48076

17. DiPiazza AT, Graham BS, Ruckwardt TJ. T cell immunity to SARS-CoV-2 following natural infection and vaccination. Biochem Biophys Res Commun. 2021;538:211217. doi:10.1016/j.bbrc.2020.10.060

18. Choudhary OP, Choudhary P, Singh I. Indias COVID-19 vaccination drive: key challenges and resolutions. Lancet Infect Dis. 2021;21(11):14831484. doi:10.1016/S1473-3099(21)00567-3

19. Chopra H, Choudhary OP. mRNA vaccines as an armor to combat the infectious diseases. Travel Med Infect Dis. 2023;52:102550. doi:10.1016/j.tmaid.2023.102550

20. Yin J, Zhao Y, Huang F, et al. Immune response and homeostasis mechanism following administration of BBIBP-CorV SARS-CoV-2 inactivated vaccine. Innovation. 2023;4(1):100359. doi:10.1016/j.xinn.2022.100359

21. Fu Z, Liang D, Zhang W, et al. Host protection against Omicron BA.2.2 sublineages by prior vaccination in spring 2022 COVID-19 outbreak in Shanghai. Front Med. 2023:114. doi:10.1007/s11684-022-0977-3

22. Robinson ML, Morris CP, Betz JF, et al. Impact of SARS-CoV-2 variants on inpatient clinical outcome. medRxiv. 2022. doi:10.1101/2022.02.02.22270337

23. Yu K, He J, Wu Y, et al. Dysregulated adaptive immune response contributes to severe COVID-19. Cell Res. 2020;30(9):814816. doi:10.1038/s41422-020-0391-9

24. Wang Y, Liu J, Burrows PD, Wang JY. B Cell Development and Maturation. Adv Exp Med Biol. 2020;1254:122. doi:10.1007/978-981-15-3532-1_1

25. Diao B, Wang C, Tan Y, et al. Reduction and functional exhaustion of T cells in patients with coronavirus disease 2019 (COVID-19). Front Immunol. 2020;11:827. doi:10.3389/fimmu.2020.00827

26. Wang H, Wang Z, Cao W, Wu Q, Yuan Y, Zhang X. Regulatory T cells in COVID-19. Aging Dis. 2021;12(7):15451553. doi:10.14336/AD.2021.0709

27. Zhang F, Wan Y, Zuo T, et al. Prolonged Impairment of Short-Chain Fatty Acid and L-Isoleucine Biosynthesis in Gut Microbiome in Patients With COVID-19. Gastroenterology. 2022;162(2):548561.e4. doi:10.1053/j.gastro.2021.10.013

28. Ren Z, Wang H, Cui G, et al. Alterations in the human oral and gut microbiomes and lipidomics in COVID-19. Gut. 2021;70(7):12531265. doi:10.1136/gutjnl-2020-323826

29. Duscha A, Gisevius B, Hirschberg S, et al. Propionic Acid Shapes the Multiple Sclerosis Disease Course by an Immunomodulatory Mechanism. Cell. 2020;180(6):10671080.e16. doi:10.1016/j.cell.2020.02.035

30. Yang W, Yu T, Huang X, et al. Intestinal microbiota-derived short-chain fatty acids regulation of immune cell IL-22 production and gut immunity. Nat Commun. 2020;11(1):4457. doi:10.1038/s41467-020-18262-6

31. Brown JA, Sanidad KZ, Lucotti S, et al. Gut microbiota-derived metabolites confer protection against SARS-CoV-2 infection. Gut Microbes. 2022;14(1):2105609. doi:10.1080/19490976.2022.2105609

32. Pascoal LB, Rodrigues PB, Genaro LM, et al. Microbiota-derived short-chain fatty acids do not interfere with SARS-CoV-2 infection of human colonic samples. Gut Microbes. 2021;13(1):19. doi:10.1080/19490976.2021.1874740

33. Yao Y, Cai X, Fei W, Ye Y, Zhao M, Zheng C. The role of short-chain fatty acids in immunity, inflammation and metabolism. Crit Rev Food Sci Nutr. 2022;62(1):112. doi:10.1080/10408398.2020.185467

Continued here:

Plasma SCFAs infection after COVID-19 vaccination | JIR - Dove Medical Press

The GOP congressman who leads the House’s probe of COVID-19’s origins says he won’t seek reelection – ABC News

November 11, 2023

The Republican congressman who leads the House GOP's investigation of the origins of COVID-19 says he won't seek reelection next year

November 10, 2023, 3:46 PM ET

2 min read

WASHINGTON -- Republican Rep. Brad Wenstrup, who leads the House GOP's investigation of the origins of COVID-19, says he won't seek reelection next year.

Wenstrup represents Ohio's 2nd Congressional District and was first elected to the House in 2012. He said in a video posted on X on Thursday that he would be stepping down to spend more time with his family.

A married father of two young children, the Cincinnati native is a doctor of podiatric medicine and colonel in the Army Reserve. As chair of the House select subcommittee on the coronavirus pandemic, Wenstrup led an inquiry into the virus' origins and the government's response.

Wenstrup, who is also a longtime member of the House Intelligence Committee, has accused U.S. intelligence of withholding key facts about its investigation into the coronavirus. Republicans on the committee last year issued a staff report arguing that there are indications that the virus may have been developed as a bioweapon inside the Chinas Wuhan Institute of Virology.

U.S. officials, however, released an intelligence report in June that rejected some points raised by those who argue COVID-19 leaked from a lab, instead reiterating that American spy agencies remain divided over how the pandemic began.

Wenstrup's announcement came the same day another longtime congressman also said he would not seek reelection next year. Derek Kilmer, a Democrat who represents the 6th District in Washington, cited similar reasons as Wenstrup in reaching his decision, noting the numerous family events he has missed due to his work in the House.

Kilmer served in the Washington State legislature before he was first elected to his House seat in 2012.

They are among nearly two dozen House members to announce they won't be running again in 2024.

Read this article:

The GOP congressman who leads the House's probe of COVID-19's origins says he won't seek reelection - ABC News

New COVID Variant HV.1: What To Know About Symptoms – TODAY

November 11, 2023

As the United States enters respiratory virus season and health officials roll out updated COVID-19 vaccines, a new COVID variant HV.1 has emerged and is currently sweeping the country.

The new omicron subvariant has rapidly overtaken other strains, including EG.5 aka Eris, to become the dominant variant in the U.S. As of late October, HV.1 is responsible for more than a quarter of all COVID-19 cases, and health officials are monitoring the new variant amid concerns of a winter COVID-19 surge.

HV.1 accounted for an estimated 25.2% of new COVID-19 cases during the two-week period ending Oct. 28, according to the latest data from theU.S. Centers for Disease Control and Prevention.

After HV.1, the next most common variant in the U.S. was EG.5, which made up 22% of cases, followed by FL.1.5.1 or Fornax, and XBB.1.16 orArcturus. (Globally, EG.5 is still the dominant strain, according to the World Health Organization.)

All of the most prevalent COVID-19 strains in the U.S. are offshoots of omicron, which first emerged in November 2021.

Although COVID-19 cases and hospitalizations have been trending downward after a late summer surge, HV.1 is continuing to pick up speed around the country.

Cases are expected to increase again this winter as was the case the past three years, Dr. William Schaffner, professor of infectious diseases at Vanderbilt University Medical Center, tells TODAY.com.

As HV.1 spreads, many are curious if the new subvariant is more contagious or severe, whether it could cause different symptoms, and if the new COVID-19 vaccines will provide protection. Heres what we know about HV.1 so far.

HV.1 is part of the omicron family. You can almost think of HV.1 as a grandchild of omicron, says Schaffner. HV.1 is a sublineage of omicron XBB.1.9.2 and a direct descendent of EG.5, according to the CDC's SARS-CoV-2 lineage tree.

The COVID family of viruses likes to mutate. Weve all learned that by now," says Schaffner. While HV.1 is mutated, it's still very close to the existing omicron subvariants, Schaffner explains.

For the most part, scientists are not concerned about new variants like HV.1, which look very similar to strains we've already seen before, NBC News reported.

However, there are a few highly mutated strains which have set off alarm bells. These include BA.2.86 or Pirola, which has an extra 36 mutations that differentiate it from XBB.1.5., and a newer variant called JN.1, which has one more mutation than Pirola.

Fortunately, neither BA.2.86 nor JN.1 are common in the U.S. right now, according to the CDC JN.1 is so rare that it makes up fewer than 0.1% of SARS-CoV-2 cases.

As for HV.1, it rapidly gained steam after it was first detected this past summer. In late July, HV.1 accounted for just 0.5% of COVID-19 cases in the U.S., CDC data show.By Sept. 30, HV.1 made up 12.5% of cases, and by November, it was the dominant strain.

One of the characteristics of this entire omicron family is that they are highly transmissible," says Schaffner. Sometimes, mutations can enable a new variant to spread more effectively or quickly, per the CDC.

Right now, it appears that HV.1 could be slightly better at spreading from person to person than previous strains, NBC News reported. The increased transmissibility of HV.1 likely explains how it became dominant so quickly in the U.S., Schaffner notes.

It appears that HV.1 could also be slightly better at escaping prior immunity to COVID-19, but not enough to cause alarm, Dr. Dan Barouch, director of the Center for Virology and Vaccine Research at Beth Israel Deaconess Medical Center in Boston, told NBC News.

Although it is more transmissible, HV.1 does not appear to produce more severe disease or lead to more hospitalizations, Schaffer says.

The symptoms caused by infection with HV.1 are similar to those caused by recent variants, says Schaffner, which include:

Congestion, sore throat and dry cough seem to be the three most prominent symptoms right now, says Schaffner.

Increasingly, doctors report that COVID-19 symptoms appear to follow a pattern of being concentrated in the upper respiratory tract, starting with a sore throat and followed by congestion or a runny nose, NBC news reported.

Coughing isn't typically a primary symptom, but it can persist. "The virus seems to produce a kind of a chronic bronchitis, so that you can have a cough syndrome that lasts beyond the period where youve recovered from other symptoms," says Schaffner.

Another trend is that COVID-19 seems to be causing milder infections, likely because people have some prior immunity. By milder, we mean it doesnt require hospitalization even though you can feel quite miserable for several days, says Schaffner.

All COVID-19 tests including PCR tests performed by a health care provider and rapid at-home antigen tests will detect HV.1, says Schaffner.

Testing is a crucial tool to protect yourself and others from COVID-19. The symptoms of HV.1 and other COVID-19 variants can look very similar to other viruses, including respiratory syncytial virus (RSV), influenza and rhinovirus, which usually causes the common cold.

"The only way to distinguish (COVID-19) from RSV and flu, both of which are now gaining steam, is by testing," says Schaffner.

Experts encourage anyone who has symptoms to get tested, especially those in high-risk groups people over the age of 65, who are immunocompromised or who have underlying health conditions.

We have treatments that can prevent more serious disease," says Schaffner, but early detection is key. COVID-19 antivirals such as Paxlovid are effective against HV.1 and other variants, but they work best when within five days of symptom onset, TODAY.com previously reported.

Testing has significantly diminished in the U.S. in the last year, which is concerning, says Schaffner.

When the U.S. federal public health emergency for COVID-19 ended in May, so did the guarantee of free testing for many people.

However, every American can still get COVID-19 tests for free or low-cost right now. One way is to order four free at-home COVID-19 tests from the government, which will be delivered by mail via the U.S. Postal Service. To order your free tests, go toCOVIDTests.gov.

In addition, all health insurance plans are required to reimburse eight at-home COVID-19 tests per month, according tothe Centers for Medicare & Medicaid Services. State Medicaid programs are also required to cover at-home tests, and Medicare beneficiaries and uninsured individuals can access free tests provided by Health & Human Services at thousands of community health centers, clinics and pharmacies.

If you still have a stockpile of tests sitting around, remember to check the expiration date and whether it's been extended bythe U.S. Food and Drug Administration.

The updated COVID-19 vaccine is recommended by the CDC for everyone ages 6 months and older. It is now widely available at pharmacies, doctor's offices and other locations around the U.S., says Schaffner.

The new boosters have been reformulated to target omicron XBB.1.5, which was the dominant COVID variant for most of 2023. While XBB.1.5 has since been overtaken by HV.1, Eris, Fornax and Arcturus, it is still closely related to these newer strains.

The updated vaccines seem to be well-matched to the variants currently circulating and making people sick, Andrew Pekosz, Ph.D., virologist at Johns Hopkins University, previously told TODAY.com.

Laboratory studies indicate that the updated booster will protect against serious disease caused by HV.1, says Schaffner. Vaccination also significantly lowers the risk of becoming hospitalized or dying, per the CDC.

However, only 23 million Americans or 4.5% of the population had received the updated shots by Oct. 27, Reuters reported.

The first phase of the new booster rollout hit several speed bumps, including supply delays, high demand, cancelled appointments and insurance obstacles. Some parents have been unable to get theirkids vaccinatedas some pharmacies and pediatrician's offices have struggled to secure enough child-size doses.

Although many of these initial issues have been resolved, says Schaffner, uptake is still slow. "We've underutilized this updated vaccine, and we anticipate that COVID will once again increase even more during the winter season," says Schaffner.

It's not too late to take advantage of the new booster, Schaffner adds, and people should get the shot as soon as they can.

The FDA has authorized three vaccine options for 2023-2024:one mRNA shot each from Moderna and Pfizer, and a protein-based non-mRNA shot from Novavax.

Insurance plans should cover the updated booster, says Schaffner, and those without insurance should still be able to get the shot for free, according to the CDC.

Were in a good place because for a considerable time now, we have not had a new variant that causes more severe disease or evades the protection of currently available vaccines, says Schaffner.

As the winter and holiday season approaches, it's important to take steps to protect yourself from COVID-19 and prevent transmission to others, especially the most vulnerable. These include:

Caroline Kee is a health reporter at TODAY based in New York City.

Read the original post:

New COVID Variant HV.1: What To Know About Symptoms - TODAY

Page 115«..1020..114115116117..120130..»
➤